1.3.7 Field assay of CRISPR/CAST package for serum samples
The total number of serum samples was 498, including 398 samples of
sheep serum and 100 cattle serum from the Tongliao Zarut Banner area
(April 2022), and Brucella DNA was extracted with aBrucella infection pretreatment kit (Zhai et al., 2017) at 100°C
for 5 min, and using the method CRISPR/CAST package as mentioned in
1.3.3, referring to the Bio-Lifesci Cas12/13 special nucleic acid test
note instructions to interpreting the results. The results were also
compared with the Taqman probe-based real-time PCR (Liu et al., 2021)
and RBT. The forward primer (bcsp31-F, ACCTTGCCCTTGCCATCAT) and reverse
primer (bcsp31-R,AGTCCGGCTTTACGCAGTCA), and probe (bcsp31-P,
FAM-TGCCGTTATAGGCCCAATAGGCAACG- BHQ1) targeting bcsp31 ofBrucella . Primers and probe were used at a final concentration of
0.2 μM with 2xPremix Ex Taq™ Probe qPCR (TaKaRa Bio Inc. Dalian, China)
and 2 μl blood DNA in a 25 μl qPCR reaction. The qPCR cycling conditions
consisted of 95 °C for 30 s, followed by 45 cycles at 95 °C for 15 s and
60 °C for 30 s.